SCN10A gene polymorphism is associated with pain sensitivity and postoperative analgesic effects in patients undergoing gynecological laparoscopy

Abstract

Background

Postoperative pain intensity is influenced by various factors, including genetic variations. The SCN10A gene encodes the Nav1.8 sodium channel protein, which is crucial for pain signal transmission in peripheral sensory neurons.

Objectives

This study aims to investigate the relationship between genetic mutations in the SCN10A gene (rs6795970) and postoperative analgesic effects following gynecological laparoscopic surgery.

Methods

Two hundred female patients undergoing gynecological laparoscopic surgery under general anesthesia were included. pain sensitivity was evaluated using the catastrophizing scale and pain sensitivity questionnaire (PSQ). Patients received patient-controlled intravenous analgesia with sufentanil and dexmedetomidine for 48 h post-surgery. Postoperative pain indicators, such as visual analog scale (VAS) scores, Ramsay scores, and side effects were recorded. SCN10A rs6795970 mutations were identified using MassARRAY SNP typing technology, and patients were categoried into homozygous mutant (AA), wild type (GG), and heterozygous mutation (GA) groups for analysis.

Results

Patients in the AA group had higher scores on the pain Catastrophizing Scale, PSQ-total, PSQ-minor, and PSQ-moderate compared to GA and GG groups (P < 0.05). VAS scores at 4, 6, and 12 h post-operation were higher in the AA group than the GG group (P < 0.05). Ramsay scores were lower in AA patients at 2 and 4 h post-operation compared to GA and GG groups (P < 0.05). The AA group exhibited more self-control analgesic pump compressions within the first 24 h post-surgery, quicker depletion of analgesics in the pump, and lower patient satisfaction with pain relief compared to GA and GG groups (P < 0.05).

Conclusions

Female patients with homozygous SCN10A mutations may experience higher preoperative pain scores and increased sensitivity to postoperative pain following gynecological laparoscopic surgery with intravenous patient-controlled analgesia.

Trial registration: www.chictr.org.cn, registration number: ChiCTR2200062425.

Introduction

Many patients experience intense pain after surgery despite advancements in analgesics and pain management techniques. Various factors, such as age, gender, ethnicity, and type of surgery, have been identified to influence pain sensitivity post-surgery [1]. Genetic research has revealed that genetic polymorphisms may also contribute to individual differences in pain perception [2, 3].

The NaV1.8 channels play a critical role in regulating action potentials in nociceptive neurons. These sodium channels, encoded by SCN10A on chromosome 3, are predominantly expressed in dorsal root ganglion (DRG) and trigeminal ganglion neurons, which are primarily nociceptive. They are also found in peripheral axons and free nerve terminals in the skin and cornea. Genome-wide association studies have linked SCN10A to cardiac conduction and dysrhythmias [4,5,6], as well as an increased risk of Brugada Syndrome [7]. SCN10A variants have also been associated with pain sensitivity. Studies have shown that carriers of the minor allele at position 1073 (rs6795970, G > A; p.Ala1073Val) exhibit reduced mechanical pain sensitivity [8]. Individuals with the GA/AA genotype have a 2.14-fold higher likelihood of experiencing inadequate pain relief after video-assisted thoracoscopic surgery compared to those with the GG genotype [9].

However, the impact of SCN10A gene variants on pain sensitivity scores and postoperative analgesic effectiveness following gynecological laparoscopic procedures in Chinese female patients is not yet fully understood. This research aims to investigate the relationship between SCN10A polymorphisms and variability in pain sensitivity, as well as postoperative pain after gynecological laparoscopic procedures in Chinese female patients.

Methods

General information

The study protocol has been approved by the Research Ethics Committee of the Chongqing Health Center for Women and Children (approval number: 2022-006) and was conducted in accordance with the Declaration of Helsinki. It was registered with the Chinese Clinical Trial Registry (ChiCTR) (www.chictr.org) with identifier ChiCTR2200062425. Informed consent was obtained from all participating patients.

Two hundred Han Chinese women who underwent gynecological laparoscopic surgery under intravenous general anesthesia at the Women and Children's Hospital of Chongqing Medical University between August 10 2022 and December 30 2022 were enrolled. The inclusion criteria were as follows: age ≥ 18 and < 60 years, ASA I–II classification; Planned gynecological laparoscopic surgery under general anesthesia with a postoperative requirement for patient-controlled intravenous analgesia (PCIA); possessing normal communication skills and the ability to correctly use a postoperative patient-controlled intravenous analgesia pump and cooperate in pain assessment; no history of allergy to anesthesia medications. The exclusion criteria were the presence of mental illness or cognitive impairments; allergy to known analgesic or sedative medications; a history of chronic pain with long-term use of analgesic or sedative medications; the presence of peripheral neuropathy symptoms or abnormal liver or kidney function.

Pain sensitivity assessment

Prior to the surgery, a qualified anesthesiologist will administer the pain sensitivity questionnaire (PSQ) and the pain catastrophizing scale (PCS) [10, 11] to assess individual pain sensitivity. The PSQ measures responses to different levels of pain stimuli and classifies individuals into PSQ moderate or PSQ minor groups based on their sensitivity. A higher score indicates greater sensitivity to pain. The PCS includes 13 self-assessment items that evaluate individuals' thoughts and emotions during pain experiences, focusing on repetitive contemplation, exaggeration and helplessness. A higher PCS score indicates a tendency towards catastrophic thinking.

Anesthesia methods and postoperative analgesia

All patients received intravenous general anesthesia following a standard protocol, which included tracheal intubation. The induction of general anesthesia involved target-controlled infusion (TCI) of remifentanil (target plasma concentration 5 ng/ml) and propofol (target plasma concentration 3.5 μg/ml), sufentanil (0.25 μg/kg) and rocuronium (0.6 mg/kg). Anesthesia was maintained with propofol and remifentanil TCI with rocuronium administered as needed. Hemodynamic indicators including heart rate (HR), mean blood pressure (MBP), and pulse oximetry(SpO₂) at different timepoints (T1: baseline, T2: skin incision, T3: establishment of pneumoperitoneum, T4: skin suture, T5: tracheal extubation), were compared among the groups.

The patient-controlled intravenous analgesia (PCIA) regimen consisted of dexmedetomidine 100 μg, sufentanil 75 μg and dexamethasone 10 mg in a total volume of 100 ml. Postoperative analgesia was maintained for 2 days following surgery. The analgesic pump used was a disposable adjustable infusion pump (PCA-100C) manufactured by Zhejiang Chen He Medical Equipment Co., Ltd., China. The infusion was administered continuously at a rate of 2 ml/h, with a lockout time of 15 min. Patients could self-administer a 0.5 ml dose by pressing the control button.

Genotype analysis

After assessing pain sensitivity, 2 ml of venous blood was collected from the patient and stored in an EDTA anticoagulant tube. The blood was gradually cooled and then stored in a freezer at − 80 °C. A standardized DNA extraction process was conducted, and the extracted DNA was tested for concentration and purity to meet the required standards. MassARRAY SNP typing technology was used for SNP (rs6795970) determination. The forward primer sequence for the 1st PCR was: ACGTTGGATGGTGAGACGTGGAAAGATGAG, the reverse primer sequence for the 2nd PCR was: ACGTTGGATGTCTCCAGGAAGCTGACATAC, and the single base extension primer sequence was: CCTACCTCAGCAGGG. The SpectraCHIP chip was analyzed using a MALDI–TOF mass spectrometer after sampling. The detection results were analyzed with TYPER 4.0 software to obtain raw data and genotype maps. The 384-well SpectroCHIP ® Bioarray chip, MassARRAY NanoInspector point prototype and MassARRAY Analyzer 4.0 mass spectrometer are all from Agena Bioscience, Inc.

Observation indicators

Pain-related parameters were assessed using the Visual Analog Scale (VAS) and Ramsay scores at 0, 2, 4, 6, 12, and 24 h post-operation. In addition, the number of self-administered analgesic pump compressions within the first 24 h, time to depletion of analgesics in the pump, 24-h postoperative analgesic dosage, longest uninterrupted sleep time on the first postoperative night, time to mobilization after surgery, time to first flatus, duration of urinary catheterization, length of postoperative hospital stay, and satisfaction score (rated out of 10) were recorded. Adverse reactions, including hypotension, respiratory depression, bradycardia, nausea, vomiting, dizziness, drowsiness, urinary retention, and chills, were monitored during postoperative analgesia in the first 48 h after surgery.

Statistical analysis

Statistical analysis was performed using SPSS version 21.0 for Windows (SPSS Inc., Chicago, IL, USA). Mean and standard deviation were calculated for continuous data, while count values were used for categorical data. Normality of continuous data was assessed using the Kolmogorov–Smirnov test. Analysis of variance (ANOVA) or the Brown–Forsythe test was used to compare continuous data among groups, depending on the equality of variance in each group. For non-parametric data, the Kruskal–Wallis test was applied. Post hoc comparisons among groups were conducted using the Tukey Honestly Significant Difference (HSD) method when applicable. Categorical data were compared using the Chi-square test or Fisher’s exact test. A P value less than 0.05 was considered statistically significant.

Results

Demographic characteristics

A total of 200 female patients were included in the study. The DNA extraction success rate was 100%, and all SNP typing tests were successful. Among the participants, 148 cases (74%) had the wild type (GG) SCN10A rs6795970 locus, 49 cases (24.5%) had heterozygote mutants (GA) of the SCN10A locus and 3 cases (1.5%) had homozygote mutants (AA) of the SCN10A locus. The distribution of the three genotypes conforms to Hardy–Weinberg equilibrium after performing a chi-square test (χ² = 0.154, P = 0.926). The included cases have representative characteristics of the population, and the distribution ratio of A and G alleles was consistent with the Allele Frequency reported on the website https://www.ncbi.nlm.nih.gov/snp/rs6795970#frequency_tab. Table 1 displays the demographic characteristics of the subjects. No statistically significant differences were found in terms of age, body weight, height, BMI, preoperative hemoglobin, hematocrit, leukocyte count and platelet count among the three SNP loci of the SCN10A (P > 0.05).

Table 1 Comparison of demography data of different SCN10A gene polymorphisms

Association between SNP and preoperative pain score

As shown in Table 1, the PCS, PSQ total score, PSQ minor score, and PSQ moderate score were significantly higher in the homozygous mutant group (group AA) compared to group GA and group GG (P < 0.05).

Hemodynamic changes

The changes in hemodynamic indices of the patients during anesthesia are shown in Table 2. Apart from the heart rate during skin suture, there were no significant differences observed in heart rate (HR), mean blood pressure (MBP), and pulse oxygen saturation among the different single-nucleotide polymorphism (SNP) loci (P > 0.05). However, the HR during skin suture (T4) in homozygote mutants (group AA) was significantly higher compared to both group GA and group GG (P < 0.05).

Table 2 Comparison of hemodynamic indicators at different timepoints of different SCN10A gene polymorphisms

Analgesic-related indicators

The VAS and Ramsay scores at 0, 2, 4, 6, 12, and 24 h post-operation (T1–T6) are shown in Table 3. Postoperative VAS scores decreased over time. Analysis of SNP genotypes revealed that VAS scores at 4, 6, and 12 h post-operation were higher in patients with homozygous mutations compared to the wild-type group (P < 0.05). However, the VAS score at 24 h post-operation was lower in patients with heterozygous mutations compared to the wild-type group (P < 0.05). Patients with homozygous mutations had lower Ramsay scores at 2 and 4 h post-operation compared to the wild-type and heterozygous mutation groups (P < 0.05).

Table 3 Comparison of postoperative pain and sedation scores of different SCN10A gene polymorphisms

The number of self-controlled analgesic pump compressions within 24 h post-operation was significantly higher in group AA compared to the wide-type and heterozygous mutation groups (P < 0.05). The analgesic pump depletion time was shorter in the homozygous mutation group compared to the wild-type (GG) and heterozygous mutation groups (GA) (P < 0.05). Patient satisfaction with pain relief was lower in group AA compared to the other two groups (P < 0.05). There were no significant differences among the groups in analgesic solution dosage at 24 h, longest continuous sleep time post-operation, time to start moving out of bed, time to start passing gas, duration of urinary catheterization, and postoperative hospitalization days.

Postoperative complications

There were no statistically significant differences in postoperative complications among the three SNP polymorphism groups, including hypotension, respiratory depression, bradycardia, nausea, vomiting, dizziness, drowsiness, urinary retention and chills (P > 0.05) (Table 4).

Table 4 Comparison of postoperative adverse reactions of different SCN10A gene polymorphisms

Discussion

Pain serves as the internal alertness system of the human body, playing a crucial role in preventing further damage and promoting tissue healing after injury [12]. Therefore, postoperative analgesia is essential for the early and effective recovery of surgical patients. Despite advancements in analgesics and pain management techniques, many patients still experience intense pain post-surgery. The analgesic response to medications varies widely among individuals due to genetic and non-genetic factors. Various variables, such as age, gender, ethnicity, and the type of surgical procedure, have been identified as influencing pain sensitivity after surgery [13]. Understanding the genetic factors underlying postoperative pain has significant implications for personalized pain management strategies. By identifying patients at higher risk for increased pain sensitivity and chronic pain development, healthcare providers can optimize analgesic interventions, tailor pain management plans and improve patient outcomes.

In the complex process of pain perception in the human body, the dorsal root ganglion (DRG) serves as a node connecting peripheral nerve endings to the central nervous system, including the spinal cord. DRG neurons receive peripheral pain signals and amplify them, converting the signals into electrical impulses transmitted to the central nervous system [14]. NaV1.8 sodium channels encoded by SCN10A play a critical role in regulating action potentials in nociceptive neurons, predominantly expressed in DRG and trigeminal ganglion neurons. These channels are primarily expressed in the periphery and play a crucial role in pain transmission. Genome-wide association studies have shown that SCN10A is involved in cardiac electrophysiology [15]. There is increasing evidence suggesting that a specific locus polymorphism (rs6795970) of the NaV1.8 channel significantly influences visceral pain perception [8, 9]. A functional assessment of this polymorphism in a discovery cohort study revealed that this genetic variant (rs6795970) alters the electrophysiological function of the Nav1.8 channel and increases thresholds for mechanical pain [8].

The evaluation of pain sensitivity triggered by mechanical pain stimuli is objective and reliable. Quantitative sensory testing (QST) is a pain sensitivity test conducted in a laboratory setting using specific instruments, with harmful stimuli, such as thermal, cold and pressure applied [16]. However, this method requires additional resources and may cause physical or psychological discomfort to patients. In this study, the pain sensitivity questionnaire (PSQ) and the pain catastrophizing scale (PCS) [10, 11] were used to assess preoperative pain sensitivity in female patients. The PSQ developed by Ruscheweyh consists of 17 items describing daily life situations and has been validated in multiple countries through clinical trials and QST [13, 17, 18]. The PCS is a widely used tool to measure trait pain catastrophizing and assess pain-related thoughts before, during, or after a painful event [19]. In this study, a comprehensive analysis was conducted comparing preoperative PCS and PSQ scores among patients with different subtypes of SCN10A. Patients with the AA genotype showed significantly higher scores compared to other patients, highlighting the impact of SCN10A (rs6795970, G > A; p.Ala1073Val) on pain sensitivity.

In this study, the postoperative analgesia pump formula included dexmedetomidine and sufentanil. It is essential to continuously monitor the visual analog scale (VAS) score and the Ramsay sedation score after the operation. Patients with homozygous mutations showed higher VAS scores at 4, 6, and 12 h post-operation, and lower Ramsay scores at 2 and 4 h compared to patients without the mutation under the same analgesic regimen. Patients with homozygous mutations required more analgesic interventions and reported lower satisfaction with postoperative pain management. These findings are consistent with previous literature [9].

Pain reactions often manifest through objective signs, such as heart rate and blood pressure, in addition to subjective feelings measured on a pain scale. Patients with AA genotype exhibited a significantly faster heart rate at the end of surgery compared to other patients, despite similar baseline heart rates and anesthesia depth before surgery. This correlation may be attributed to the influence of SCN10A on cardiac conduction and its role in the development of arrhythmias. A study by Liu et al. [20] confirmed the involvement of SCN10A in the cardiac response to atropine in both human and animal models, showing an association between SCN10A(rs6795970) and heart rate response to atropine. SCN10A knockout mice exhibited lower heart rate responses to atropine and methoctramine. However, the exact reason for this discrepancy being apparent only during skin suturing remains unclear.

The limitations of this study include the small number of homozygous mutations identified in the AA group based on genotype analysis, which was due to the challenge of predicting the number of patients accurately beforehand. This disparity, along with the exclusively female composition of participants, may introduce data bias. To address these limitations, future studies should consider a larger sample size to ensure adequate representation of homozygous mutations. Despite these limitations, the study results offer strong evidence supporting the significant role of SCN10A in pain sensitivity and the need for personalized postoperative analgesia.

Conclusions

In gynecological laparoscopic operations, female patients with homozygous mutations in SCN10A tend to have higher preoperative pain scores and increased sensitivity to postoperative pain with patient-controlled analgesia.